|
PackGene Biotech lnc
ssaav u6 sgrna efs zsgreen plasmid Ssaav U6 Sgrna Efs Zsgreen Plasmid, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc12259261-185-8-12?v=PackGene+Biotech+lnc Average 94 stars, based on 1 article reviews
ssaav u6 sgrna efs zsgreen plasmid - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Danaher Inc
alt rtm crispr guide rnas Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/bio_rxiv__2020__10__05__317925-593-11-16?v=Danaher+Inc Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
OriGene
interspaced short palindromic repeats crispr associated protein 9 single guide rna Interspaced Short Palindromic Repeats Crispr Associated Protein 9 Single Guide Rna, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/us12479807-263-31-42?v=OriGene Average 93 stars, based on 1 article reviews
interspaced short palindromic repeats crispr associated protein 9 single guide rna - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
crispr guide Crispr Guide, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc06575637__pnas__1819825116__sapp-71-34-36?v=Addgene+inc Average 86 stars, based on 1 article reviews
crispr guide - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
GenScript corporation
aldh2 crispr guide rna cccgctcgatcagatcggcc Aldh2 Crispr Guide Rna Cccgctcgatcagatcggcc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pm40558540-73-0-14?v=GenScript+corporation Average 90 stars, based on 1 article reviews
aldh2 crispr guide rna cccgctcgatcagatcggcc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
dpp4 protein ![]() Dpp4 Protein, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc10873275-63-9-23?v=GenScript+corporation Average 90 stars, based on 1 article reviews
dpp4 protein - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
crispri sgrna guides ![]() Crispri Sgrna Guides, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc10267698-223-24-31?v=Broad+Institute+Inc Average 90 stars, based on 1 article reviews
crispri sgrna guides - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) ![]() Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/10__1074_slash_jbc__ra118__006693-184-10-28?v=GenScript+corporation Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
ap2a2 crispr guide sgrna 2 ![]() Ap2a2 Crispr Guide Sgrna 2, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc06007032-57-0-8?v=Broad+Institute+Inc Average 90 stars, based on 1 article reviews
ap2a2 crispr guide sgrna 2 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) ![]() Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pm38307859-283-32-48?v=GenScript+corporation Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
hrh1-targeting single guide rna (sghrh1; 5’-cgatcaagtccgccaccgag-3) ![]() Hrh1 Targeting Single Guide Rna (Sghrh1; 5’ Cgatcaagtccgccaccgag 3), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc09895059-208-13-26?v=GenScript+corporation Average 90 stars, based on 1 article reviews
hrh1-targeting single guide rna (sghrh1; 5’-cgatcaagtccgccaccgag-3) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
crispr guide rnas ![]() Crispr Guide Rnas, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guides/pmc09098221-380-6-18?v=ToolGen+Incorporated Average 90 stars, based on 1 article reviews
crispr guide rnas - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Antibody Therapeutics
Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks
doi: 10.1093/abt/tbad030
Figure Lengend Snippet: Generation of soluble recombinant human ACE2-Fc and DPP4-Fc protein as decoy receptors to SARS-CoV-2 and MERS-CoV, respectively. Recombinant human ACE2-Fc and DPP4-Fc proteins were generated by fusing the C terminus of the human ACE2 and DPP4 extracellular domains to a human IgG Fc domain as coronaviruses inhibitors.
Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD,
Techniques: Recombinant, Generated
Journal: Antibody Therapeutics
Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks
doi: 10.1093/abt/tbad030
Figure Lengend Snippet: Purified recombinant WT ACE2-Fc, Modified ACE2-Fc, DPP4-Fc, Beta RBD-Fc, IgG ab1-IgG and M336-IgG. (A) The stained SDS-PAGE gel under reducing conditions shows WT ACE2-Fc, Modified ACE2-Fc and DPP4-Fc at ~100 kDa, Beta RBD-Fc at ~ 60 kDa, and IgGs light chain at ~25 kDa and heavy chain at ~50 kDa. (B) Stained gel under nonreducing conditions shows WT ACE2-Fc, Modified ACE2-Fc and DPP4-Fc at ~200 kDa, Beta RBD-Fc at ~120 kDa and IgGs at ~ 150 kDa. (C) Western blot stained with anti-human IgG-HRP polyclonal antibody confirmed that Fc-fusion proteins and IgGs mAbs were efficiently expressed and purified. (D) ELISA for anti-SARS-CoV-2 and anti-MERS-CoV Fc-fusion proteins and IgGs. ELISA plate was coated with 1 μg/mL recombinant SARS-CoV-S and MERS-CoV-S proteins, then probed with 3 μg/mL of the anti-SARS-CoV-2 and anti-MERS-CoV Fc-fusion proteins and IgGs mAbs. Binding was detected using HRP-conjugated anti-human IgG polyclonal antibody. Error bars represent standard deviations.
Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD,
Techniques: Purification, Recombinant, Modification, Staining, SDS Page, Western Blot, Enzyme-linked Immunosorbent Assay, Binding Assay
Journal: Antibody Therapeutics
Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks
doi: 10.1093/abt/tbad030
Figure Lengend Snippet: A schematic illustration of the MERS-CoV RBD sequences in humans (A) and camels (B). The representation shows the DPP4 and M336-IgG epitopes as well as the pseudovirus variants that are included in this report. Variants found from the multiple sequence alignment of the RBD sequences with their number of occurrences indicated at the top of the residues.
Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD,
Techniques: Sequencing
Journal: Antibody Therapeutics
Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks
doi: 10.1093/abt/tbad030
Figure Lengend Snippet: Neutralization of MERS-CoV pseudotyped virus using receptor trap and mAb. The inhibitory effect of varying concentrations of DPP4-Fc and M336-IgG was tested against MERS-CoV pseudovirus. IC 50 values of DPP4-Fc and M336-IgG are shown. Data are shown as the mean ± SD of duplicates. Dotted lines represent cutoffs of the assays.
Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD,
Techniques: Neutralization, Virus
Journal: The EMBO Journal
Article Title: Termination of STING responses is mediated via ESCRT ‐dependent degradation
doi: 10.15252/embj.2022112712
Figure Lengend Snippet: A dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e., sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce sgRNA expression. Cells were then left untreated (UT), or treated with 20 μg/ml DMXAA or 10 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. B, C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml Dox to induce sgRNA expression. Cells were then left UT, or treated with 20 μg/ml DMXAA or 5 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cell supernatant was collected and assayed for secreted IFNβ (B) and IL6 (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where * P < 0.05, *** P < 0.001, **** P < 0.0001. n.d., not detected. D–F dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e. 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Ifnb1 (D), Isg15 (E) and Irf7 (F) was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Tukey's multiple comparisons test, where * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Bars display significant differences between dCas9 and sgRNA knockdowns in the absence of H‐151. Additional asterisks represent significant differences between the absence or presence of H‐151 across the same cell line. Source data are available online for this figure.
Article Snippet: Third‐generation lentiviral transduction (see below) was used to generate iBMDMs expressing blasticidin‐selectable dCas9‐KRAB, which were selected with 5 μg/ml blasticidin for ~ 72 h.
Techniques: Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Incubation, Purification
Journal: The EMBO Journal
Article Title: Termination of STING responses is mediated via ESCRT ‐dependent degradation
doi: 10.15252/embj.2022112712
Figure Lengend Snippet: A–C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce sgRNA expression. Cells were then left untreated (UT), or treated with 500 ng/ml LPS or 200 ng/ml Pam3CSK4 (P3C) for 6 h. A Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. (B, C) Cell supernatant was collected and assayed for secreted IL‐6 (B) or TNF (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where no statically significant differences were observed across cell lines for the same treatment. D dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e., 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Il6 was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where no statistically significant changes were observed. E VPS4a WT or VPS4a E228Q dominant negative BMDMs were left UT or treated with 1 μg/ml Dox for 4 h. iBMDMs were then further left UT or treated with 10 μg/ml 2′3′‐cGAM(PS)2 for 4 h. Cell supernatant was collected and secreted IL‐6 was measured by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using one‐way ANOVA using Bonferroni's multiple comparisons test, where ** P < 0.01, *** P < 0.001. n.d., not detected. Source data are available online for this figure.
Article Snippet: Third‐generation lentiviral transduction (see below) was used to generate iBMDMs expressing blasticidin‐selectable dCas9‐KRAB, which were selected with 5 μg/ml blasticidin for ~ 72 h.
Techniques: Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Incubation, Purification, Dominant Negative Mutation
Journal: Cell host & microbe
Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection
doi: 10.1016/j.chom.2018.05.006
Figure Lengend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
Article Snippet:
Techniques: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation
Journal: Cell host & microbe
Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection
doi: 10.1016/j.chom.2018.05.006
Figure Lengend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.
Article Snippet:
Techniques: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay
Journal: Cell host & microbe
Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection
doi: 10.1016/j.chom.2018.05.006
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy